Clik here to view.
Closure Compiler in JavaScript
How does this work? This isn't a rewrite of Closure in JavaScript. Instead, we compile the Java source to JS to run under Node, or even inside a plain old browser. Every post or resource you see about...
View ArticleClik here to view.
GRiSP, a Bare Metal Erlang VM for IoT
Real-time embedded operating system Erlang is a programming language designed for creating scalable, networked software systems. It has built-in support for concurrency, distribution, and fault...
View ArticleClik here to view.
I'm giving up on PGP
After years of wrestling GnuPG with varying levels of enthusiasm, I came to the conclusion that it's just not worth it, and I'm giving up. At least on the concept of long term PGP keys.This is not...
View ArticleClik here to view.
Google says it will run entirely on renewable energy in 2017
PhotoGoogle headquarters in Mountain View, Calif. Officials hope to be dependent on renewable energy by next year. Last year, the online company consumed as much energy as San Francisco.Credit Justin...
View ArticleClik here to view.
QEMU Advent Calendar
QEMU Advent Calendar 2016Brightening your days in the winter holiday season. This advent calendar is brought to you by theQEMU community.Day 1MikeOS is a 16-bit real mode OS for x86-compatible PCs,...
View ArticleClik here to view.
It Takes 6 Days to Change 1 Line of Code (2015)
(A true story.)Philip (President): Our factory is underutilized by 10%. Either we start building more of our backlog or we lay people off. I'd rather keep everyone busy, build inventory, and get ahead...
View ArticleClik here to view.
How to Ship Side Projects
Working on side projects helps me learn new technologies, improve as an engineer and designer, and exercise my creativity. Through building side projects (which range from the mildly useful to the...
View ArticleClik here to view.
Dark Patterns – User Interfaces Designed to Trick People
A Dark Pattern is a user interface that has been carefully crafted to trick users into doing things, such as buying insurance with their purchase or signing up for recurring bills.Normally when you...
View ArticleClik here to view.
Apple to Start Publishing AI Research
by December 6, 2016 — 1:34 PM ESTDecember 6, 2016 — 1:34 PM ESTApple Inc. will allow its artificial intelligence teams to publish research papers for the first time, marking a significant change in...
View ArticleClik here to view.
How Doctors Die (2011)
by Ken Murray November 30, 2011 by Ken Murray |November 30, 2011Years ago, Charlie, a highly respected orthopedist and a mentor of mine, found a lump in his stomach. He had a surgeon explore the area,...
View ArticleClik here to view.
Vladimir Nabokov and Edmund Wilson’s Epic Literary Feud
Alex Beam's brilliant bookThe Feud: Vladimir Nabokov, Edmund Wilson, and the End of a Beautiful Friendshipcharts the rise and fall of the friendship of the two writers. Among the public barbs in the...
View ArticleClik here to view.
BSD libc contains a buffer overflow vulnerability
Original Release date: 06 Dec 2016 | Last revised: 06 Dec 2016OverviewThe BSD libc library is vulnerable to a classic buffer overflow.DescriptionCWE-120: Buffer Copy without Checking Size of Input...
View ArticleClik here to view.
Clik here to view.
Pebble's next step
December 7, 2016 #TinyMomentsOfAwesomeBehind the ScenesCommunityDevelopmentHardwareKickstarter UpdateLifestyleNewsSoftwareNo Comments community, ecosystem, fitness, hardware, health, kickstarter,...
View ArticleClik here to view.
DoomRL Open Source Release
README.mdDRL a.k.a. doomrl, a.k.a, D**m, the Roguelikehttp://drl.chaosforge.org/This release is dedicated to *eniMax, and the Jupiter Hell...
View ArticleClik here to view.
The FSF Allows No Derivatives, and That's a Mistake
Adapted from a Diaspora post written on 30 September 2013. Last edited on 19 December 2013.I really like the Free Software Foundation (FSF). They pioneered free software and continue to be a very...
View ArticleClik here to view.
Night vision glasses: nanocrystals allow direct vision into infrared
Imagine seeing colours in the infrared, or gaining night vision simply by putting on a pair of glasses. Humans can see in a tiny bandwidth of the light spectrum: infrared, ultraviolet, and x-rays are...
View ArticleClik here to view.
Tracking Down a Python Memory Leak
"I thought that memory leaks were impossible in Python?", I said to myself, staring incredulously at my screen.It was 8:00 PM. The memory use of my crawler was slowly, but steadily increasing. As I...
View ArticleClik here to view.
Set in Your Ways: Perl 6’s Setty and Baggy Types
There’s a relatively common pattern I see with people writing code that counts… say, DNA bases in a string:my%counts;%counts{$_}++for'AGTCAGTCAGTCTTTCCCAAAAT'.comb;say%counts<A T G C>; # (7 7 3...
View ArticleClik here to view.
An Algebra of Graphs
Graph theory is my favourite topic in mathematics and computing science and in this blog post I’ll introduce an algebra of graphs that I’ve been working on for a while. The algebra has become my go-to...
View Article